LILRA1 (NM_001278318) Human Untagged Clone
CAT#: SC335118
LILRA1 (untagged) - Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), transcript variant 2
CNY 2950.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD85I; LIR-6; LIR6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001278318, the custom clone sequence may differ by one or more nucleotides
ATGACCCCCATCGTCACAGTCCTGATCTGTCTCAGGCTGAGTCTGGGCCCCCGGACCCACGTGCAGGCAG GGACCCTCCCCAAGCCCACACTCTGGGCTGAGCCAGGCTCTGTGATCACCCAGGGGAGTCCCGTGACCCT CTGGTGTCAGGGGATCCTGGAGACCCAGGAGTACCGTCTGTATAGAGAAAAGAAAACAGCACCCTGGATT ACACGGATCCCACAGGAGATTGTGAAGAAGGGCCAGTTCCCCATCCCATCCATCACCTGGGAACACACAG GGCGGTATCGCTGTTTCTACGGTAGCCACACTGCAGGCTGGTCAGAGCCCAGTGACCCCCTGGAGCTGGT GGTGACAGGAGCCTACATCAAACCCACCCTCTCAGCTCTACCCAGCCCTGTGGTGACCTCAGGAGGGAAC GTGACCCTCCATTGTGTCTCACAGGTGGCATTTGGCAGCTTCATTCTGTGTAAGGAAGGAGAAGATGAAC ACCCACAATGCCTGAACTCACAGCCCCGTACCCATGGGTGGTCCCGGGCCATCTTCTCTGTGGGCCCCGT GAGCCCGAGTCGCAGGTGGTCGTACAGGTGCTATGCTTATGACTCGAACTCTCCCCATGTGTGGTCTCTA CCCAGTGATCTCCTGGAGCTCCTGGTCCTAGGAGCAGCTGAGACCCTCAGCCCACCACAAAACAAGTCCG ATTCCAAGGCTGGAGCAGCTAACACCCTCAGCCCATCACAAAACAAGACTGCCTCACACCCCCAGGATTA CACAGTGGAGAATCTCATCCGCATGGGCATAGCTGGCTTGGTCCTGGTGGTCCTCGGGATTCTGCTATTT GAGGCTCAGCACAGCCAGAGAAGCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001278318 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001278318.1, NP_001265247.1 |
RefSeq Size | 2688 bp |
RefSeq ORF | 870 bp |
Locus ID | 11024 |
UniProt ID | O75019 |
Gene Summary | This gene encodes an activating member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein is predominantly expressed in B cells, interacts with major histocompatibility complex class I ligands, and contributes to the regulation of immune responses. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013] Transcript Variant: This variant (2, also known as LIR6b) lacks two consecutive in-frame exons in the coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC237224 | LILRA1 (myc-DDK-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), transcript variant 2 |
CNY 3990.00 |
|
RG237224 | LILRA1 (tGFP-tagged) - Human leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 1 (LILRA1), transcript variant 2 |
CNY 4370.00 |