PKD1L2 (NM_001278423) Human Untagged Clone

CAT#: SC335235

PKD1L2 (untagged) - Human polycystic kidney disease 1-like 2 (gene/pseudogene) (PKD1L2), transcript variant 5



  "NM_001278423" in other vectors (2)

CNY 3040.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
PKD1L2 Rabbit polyclonal Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PC1L2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335235 representing NM_001278423.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGGAGGACTCTCCAGTGGCTATGTTCAGCTGGTATTTGGACAACACCCCAACAGAGCAGGCTGAG
CCCCTCCTGGATGCCTGCAGACTCAGAGGATTTTGGCCAAGGTCCTTAACCCTCCTCCAGAGCAACACC
TCCACGTTGCTGTTGAACAGCTCGTTTCTGCAGTCCCGGGGAGAGGTCATCCGAATCAGAGCCACAGCA
CTGACCAGGCATGCCTATGGGGAGGACACCTATGTGATCAGCACTGTGCCTCCCCGTGAGGTGCCTGCC
TGCACTATTGCCCCAGAGGAGGGCACCGTTCTGACGAGCTTTGCCATCTTCTGCAACGCCTCCACAGCC
CTGGGACCCCTGGAGTTCTGCTTCTGTCTGGAATCAGGTTCCTGCCTACACTGTGGCCCTGAACCTGCC
CTCCCATCAGTGTATCTGCCACTTGGAGAGGAGAACAATGACTTTGTGCTGACAGTAGTTATTTCTGCC
ACCAATCGTGCAGGGGACACGCAGCAGACCCAGGCCATGGCTAAGGTGGCACTCGGAGACACATGTGTT
GAGGATGTAGCATTCCAGGCTGCCGTGTCAGAGAAAATCCCCACAGCTCTGCAAGGCGAGGGTGGCCCC
GAGCAGCTCCTCCAGCTGGCCAAGGCTGTGTCCTCCATGCTGAACCAAGAGCATGAAAGCCAGGGCTCA
GGACAGTCACTGAGCATAGACGTCAGACAGAAGGTCAGAGAGCATGTGCTGGGATCACTGTCTGCAGTC
ACCACCGGCTTGGAGGACGTGCAGAGGGTGCAGGAGCTGGCCGAGGTGCTGAGAGAGGTGACCTGCCGG
AGTAAGGAACTCACACCCTCGGCCCAGGGGTCCTGCATGGGCGATTCATGGGAAGGTGCCCCTCCTGCT
GCCCATGTATCTCACGCTAGGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278423
Insert Size 921 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278423.1
RefSeq Size 1533 bp
RefSeq ORF 921 bp
Locus ID 114780
UniProt ID Q7Z442
Protein Families Druggable Genome
MW 32.8 kDa
Gene Summary This gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a latrophilin/CL-1-like GPCR proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may function as a component of cation channel pores. This gene appears to be a polymorphic pseudogene in humans, and the reference genome encodes a non-functional allele. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2019]
Transcript Variant: This variant (5) lacks several 5' and 3' exons but includes alternate 5' and 3' exons, and it thus differs in both UTRs, uses a downstream in-frame start codon and has an alternate 3' coding region, compared to variant 1. The encoded isoform (e) is shorter and has a distinct C-terminus, compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...