Integrin Linked Kinase (ILK) (NM_001278442) Human Untagged Clone

CAT#: SC335308

ILK (untagged) - Human integrin-linked kinase (ILK), transcript variant 5



  "NM_001278442" in other vectors (2)

CNY 3140.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
ILK mouse monoclonal antibody, clone OTI2H3 (formerly 2H3)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HEL-S-28; ILK-1; ILK-2; P59; p59ILK
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335308 representing NM_001278442.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCTGTGGACAAAGCCAAGGCACCCCTGAGAGAGCTTCTCCGAGAGCGGGCAGAGAAGATGGGCCAG
AATCTCAACCGTATTCCATACAAGGACACATTCTGGAAGGGGACCACCCGCACTCGGCCCCGAAATGGA
ACCCTGAACAAACACTCTGGCATTGACTTCAAACAGCTTAACTTCCTGACGAAGCTCAACGAGAATCAC
TCTGGAGAGCTATGGAAGGGCCGCTGGCAGGGCAATGACATTGTCGTGAAGGTGCTGAAGGTTCGAGAC
TGGAGTACAAGGAAGAGCAGGGACTTCAATGAAGAGTGTCCCCGGCTCAGGATTTTCTCGCATCCAAAT
GTGCTCCCAGTGCTAGGTGCCTGCCAGTCTCCACCTGCTCCTCATCCTACTCTCATCACACACTGGATG
CCGTATGGATCCCTCTACAATGTACTACATGAAGGCACCAATTTCGTCGTGGACCAGAGCCAGGCTGTG
AAGTTTGCTTTGGACATGGCAAGGGGCATGGCCTTCCTACACACACTAGAGCCCCTCATCCCACGACAT
GCACTCAATAGCCGTAGTGTAATGATTGATGAGGACATGACTGCCCGAATTAGCATGGCTGATGTCAAG
TTCTCTTTCCAATGTCCTGGTCGCATGTATGCACCTGCCTGGGTAGCCCCCGAAGCTCTGCAGAAGAAG
CCTGAAGACACAAACAGACGCTCAGCAGACATGTGGAGTTTTGCAGTGCTTCTGTGGGAACTGGTGACA
CGGGAGGTACCCTTTGCTGACCTCTCCAATATGGAGATTGGAATGAAGGTGGCATTGGAAGGCCTTCGG
CCTACCATCCCACCAGGTATTTCCCCTCATGTGTGTAAGCTCATGAAGATCTGCATGAATGAAGACCCT
GCAAAGCGACCCAAATTTGACATGATTGTGCCTATCCTTGAGAAGATGCAGGACAAGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278442
Insert Size 957 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278442.1
RefSeq Size 1631 bp
RefSeq ORF 957 bp
Locus ID 3611
UniProt ID Q13418
Protein Families Druggable Genome, Protein Kinase
Protein Pathways Endometrial cancer, Focal adhesion, PPAR signaling pathway
MW 36.5 kDa
Gene Summary This gene encodes a protein with a kinase-like domain and four ankyrin-like repeats. The encoded protein associates at the cell membrane with the cytoplasmic domain of beta integrins, where it regulates integrin-mediated signal transduction. Activity of this protein is important in the epithelial to mesenchymal transition, and over-expression of this gene is implicated in tumor growth and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (5) uses an alternate splice site in the 5' UTR, lacks an exon in the 5' coding region, and initiates translation at a downstream in-frame start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...