C2 (NM_001282459) Human Untagged Clone

CAT#: SC335371

C2 (untagged) - Human complement component 2 (C2), transcript variant 6



  "NM_001282459" in other vectors (2)

CNY 3230.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


C2 mouse monoclonal antibody,clone OTI12G10
    • 100 ul

CNY 1999.00
CNY 2700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARMD14; CO2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335371 representing NM_001282459.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCCCACTGATGGTTCTTTTTTGCCTGCTGTTCCTGTACCCAGGTCTGGCAGACTCGGCTCCCTCC
TGCCCTCAGAACGTGAATATCTCGGGTGGCACCTTCACCCTCAGCCATGGCTGGGCTCCTGGGAGCCTT
CTCACCTACTCCTGCCCCCAGGGCCTGTACCCATCCCCAGCATCACGGCTGTGCAAGAGCAGCGGACAG
TGGCAGACCCCAGGAGCCACCCGGTCTCTGTCTAAGGCGGTCTGCAAACCTGTGCGCTGTCCAGCCCCT
GTCTCCTTTGAGAATGGCATTTATACCCCACGGCTGGGGTCCTATCCCGTGGGTGGCAATGTGAGCTTC
GAGTGTGAGGATGGCTTCATATTGCGGGGCTCGCCTGTGCGTCAGTGTCGCCCCAACGGCATGTGGGAT
GGAGAAACAGCTGTGTGTGATAATGGGGCTGGCCACTGCCCCAACCCAGGCATTTCACTGGGCGCAGTG
CGGACAGGCTTCCGCTTTGGTCATGGGGACAAGGTCCGCTATCGCTGCTCCTCGAATCTTGTGCTCACG
GGGTCTTCGGAGCGGGAGTGCCAGGGCAACGGGGTCTGGAGTGGAACGGAGCCCATCTGCCGCCAACCC
TACTCTTATGACTTCCCTGAGGACGTGGCCCCTGCCCTGGGCACTTCCTTCTCCCACATGCTTGGGGCC
ACCAATCCCACCCAGAAGACAAAGGAAAGCCTGGGCCGTAAAATCCAAATCCAGCGCTCTGGTCATCTG
AACCTCTACCTGCTCCTGGACTGTTCGCAGAGTGTGTCGGAAAATGACTTTCTCATCTTCAAGGAGAGC
GCCTCCCTCATGGTGGACAGGGTCAGGAATCAGGAGTCTGCCTGCAGCAGAGGCCTTCCTGTGCTCACT
ATCTCTCTCTGTCTCCTTCCCCTCCTCAGAACCCCACTCACAGCCCACCTCCTCCAAGAAGTCTTCTCA
GATTATACTCATGCCATGTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282459
Insert Size 987 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001282459.1
RefSeq Size 1916 bp
RefSeq ORF 987 bp
Locus ID 717
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Complement and coagulation cascades, Systemic lupus erythematosus
MW 35.5 kDa
Gene Summary Component C2 is a serum glycoprotein that functions as part of the classical pathway of the complement system. Activated C1 cleaves C2 into C2a and C2b. The serine proteinase C2a then combines with complement factor 4b to create the C3 or C5 convertase. Deficiency of C2 has been reported to associated with certain autoimmune diseases and SNPs in this gene have been associated with altered susceptibility to age-related macular degeneration. This gene localizes within the class III region of the MHC on the short arm of chromosome 6. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described in publications but their full-length sequence has not been determined.[provided by RefSeq, Mar 2009]
Transcript Variant: This variant (6) uses an alternate 3' exon structure, and thus differs in the 3' coding region and 3' UTR compared to variant 1. It encodes isoform 6 which is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...