GAPDH (NM_001289745) Human Untagged Clone

CAT#: SC335420

GAPDH (untagged) - Human glyceraldehyde-3-phosphate dehydrogenase (GAPDH), transcript variant 3



  "NM_001289745" in other vectors (2)

CNY 3,230.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Mouse monoclonal anti-GAPDH antibody, clone OTI2D9 (formerly 2D9), loading control
    • 100 ul

CNY 600.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G3PD; GAPD; HEL-S-162eP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335420 representing NM_001289745.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGAAGGTGAAGGTCGGAGTCAACGGATTTGGTCGTATTGGGCGCCTGGTCACCAGGGCTGCTTTT
AACTCTGGTAAAGTGGATATTGTTGCCATCAATGACCCCTTCATTGACCTCAACTACATGGTTTACATG
TTCCAATATGATTCCACCCATGGCAAATTCCATGGCACCGTCAAGGCTGAGAACGGGAAGCTTGTCATC
AATGGAAATCCCATCACCATCTTCCAGGAGCGAGATCCCTCCAAAATCAAGTGGGGCGATGCTGGCGCT
GAGTACGTCGTGGAGTCCACTGGCGTCTTCACCACCATGGAGAAGGCTGGGGCTCATTTGCAGGGGGGA
GCCAAAAGGGTCATCATCTCTGCCCCCTCTGCTGATGCCCCCATGTTCGTCATGGGTGTGAACCATGAG
AAGTATGACAACAGCCTCAAGATCATCAGCAATGCCTCCTGCACCACCAACTGCTTAGCACCCCTGGCC
AAGGTCATCCATGACAACTTTGGTATCGTGGAAGGACTCATGACCACAGTCCATGCCATCACTGCCACC
CAGAAGACTGTGGATGGCCCCTCCGGGAAACTGTGGCGTGATGGCCGCGGGGCTCTCCAGAACATCATC
CCTGCCTCTACTGGCGCTGCCAAGGCTGTGGGCAAGGTCATCCCTGAGCTGAACGGGAAGCTCACTGGC
ATGGCCTTCCGTGTCCCCACTGCCAACGTGTCAGTGGTGGACCTGACCTGCCGTCTAGAAAAACCTGCC
AAATATGATGACATCAAGAAGGTGGTGAAGCAGGCGTCGGAGGGCCCCCTCAAGGGCATCCTGGGCTAC
ACTGAGCACCAGGTGGTCTCCTCTGACTTCAACAGCGACACCCACTCCTCCACCTTTGACGCTGGGGCT
GGCATTGCCCTCAACGACCACTTTGTCAAGCTCATTTCCTGGTATGACAACGAATTTGGCTACAGCAAC
AGGGTGGTGGACCTCATGGCCCACATGGCCTCCAAGGAGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001289745
Insert Size 1008 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001289745.1
RefSeq Size 1513 bp
RefSeq ORF 1008 bp
Locus ID 2597
UniProt ID P04406
Protein Families ES Cell Differentiation/IPS
Protein Pathways Alzheimer's disease, Glycolysis / Gluconeogenesis, Metabolic pathways
MW 36.1 kDa
Gene Summary This gene encodes a member of the glyceraldehyde-3-phosphate dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The product of this gene catalyzes an important energy-yielding step in carbohydrate metabolism, the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate in the presence of inorganic phosphate and nicotinamide adenine dinucleotide (NAD). The encoded protein has additionally been identified to have uracil DNA glycosylase activity in the nucleus. Also, this protein contains a peptide that has antimicrobial activity against E. coli, P. aeruginosa, and C. albicans. Studies of a similar protein in mouse have assigned a variety of additional functions including nitrosylation of nuclear proteins, the regulation of mRNA stability, and acting as a transferrin receptor on the cell surface of macrophage. Many pseudogenes similar to this locus are present in the human genome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 1. Variants 1, 3, and 4 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...