MRPS27 (NM_001286751) Human Untagged Clone

CAT#: SC335590

MRPS27 (untagged) - Human mitochondrial ribosomal protein S27 (MRPS27), transcript variant 3



  "NM_001286751" in other vectors (2)

CNY 3420.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
MRPS27 mouse monoclonal antibody, clone OTI6E5 (formerly 6E5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MRP-S27; S27mt
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335590 representing NM_001286751.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGATAAAACATTTGAGAGAAAGTTGCCTGTTAGTTCTTTAACAATATCACGGCTTATAGACAACATT
TCCTCTCGGGAAGAGATAGATCATGCAGAGTATTACCTTTACAAGTTTCGACACAGCCCCAACTGCTGG
TACCTGAGAAACTGGACTATCCACACCTGGATTAGGCAGTGTCTAAAATATGATGCACAAGACAAAGCC
CTATATACCCTTGTAAATAAGGTTCAATATGGAATTTTTCCAGATAACTTTACATTCAATTTACTGATG
GATTCTTTCATAAAGAAAGAAAATTACAAAGATGCTTTATCTGTGGTTTTTGAGGTCATGATGCAAGAA
GCCTTTGAAGTGCCTTCCACCCAACTTCTCTCCCTCTATGTTTTATTTCATTGCCTGGCAAAGAAGACA
GACTTCAGTTGGGAAGAGGAGAGGAACTTTGGTGCATCCCTTTTGCTTCCAGGCCTAAAACAAAAGAAC
TCAGTGGGTTTCAGTTCCCAGTTGTATGGCTATGCACTTCTTGGGAAGGTGGAGTTGCAGCAAGGGCTA
CGGGCTGTGTACCACAACATGCCTCTGATATGGAAACCAGGCTACCTTGACAGAGCCCTTCAAGTGATG
GAGAAAGTGGCTGCCTCCCCAGAAGACATAAAGCTGTGTAGAGAAGCGCTCGATGTGCTGGGTGCAGTG
CTGAAGGCTCTGACTTCAGCTGATGGGGCTTCAGAGGAGCAGTCCCAAAATGATGAAGACAACCAGGGG
TCAGAAAAACTGGTGGAGCAGTTAGACATCGAGGAAACAGAGCAGTCCAAGCTTCCTCAATACCTGGAA
CGATTTAAGGCCTTACATTCTAAGCTTCAAGCTCTGGGCAAAATTGAGTCAGAAGGTCTTTTAAGTCTG
ACCACCCAGCTTGTCAAGGAAAAACTCTCCACCTGTGAAGCAGAGGACATCGCCACCTATGAGCAGAAT
CTGCAGCAGTGGCATCTAGACCTTGTACAGTTGATCCAGAGAGAACAGCAACAGAGGGAGCAAGCGAAG
CAGGAGTACCAGGCTCAGAAAGCAGCAAAGGCATCTGCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001286751
Insert Size 1077 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001286751.1
RefSeq Size 2765 bp
RefSeq ORF 1077 bp
Locus ID 23107
MW 41.3 kDa
Gene Summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that may be a functional partner of the death associated protein 3 (DAP3). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
Transcript Variant: This variant (3) differs in the 5' UTR and has multiple coding region differences, compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (3) with a shorter N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...