Carboxypeptidase B2 (CPB2) (NM_001278541) Human Untagged Clone

CAT#: SC335790

CPB2 (untagged) - Human carboxypeptidase B2 (plasma) (CPB2), transcript variant 2



  "NM_001278541" in other vectors (2)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
CPB2 mouse monoclonal antibody, clone OTI3D5 (formerly 3D5)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CPU; PCPB; TAFI
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335790 representing NM_001278541.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAGCTTTGCAGCCTTGCAGTCCTTGTACCCATTGTTCTCTTCTGTGAGCAGCATGTCTTCGCGTTT
CAGAGTGGCCAAGTTCTAGCTGCTCTTCCTAGAACCTCTAGGCAAGTTCAAGTTCTACAGAATCTTACT
ACAACATATGAGATTGTTCTCTGGCAGCCGGTAACAGCTGACCTTATTGTGAAGAAAAAACAAGTCCAT
TTTTTTGTAAATGCATCTGATGTCGACAATGTGAAAGCCCATTTAAATGTGAGCGGAATTCCATGCAGT
GTCTTGCTGGCAGATGTGGAAGATCTTATTCAACAGCAGATTTCCAACGACACAGTCAGCCCCCGAGCC
TCCGCATCGTACTATGAACAGTATCACTCACTAAATGAAATCTATTCTTGGATAGAATTTATAACTGAG
AGGCATCCTGATATGCTTACAAAAATCCACATTGGATCCTCATTTGAGAAGTACCCACTCTATGTTTTA
AAGGTTTCTGGAAAAGAACAAGCAGCCAAAAATGCCATATGGATTGACTGTGGAATCCATGCCAGAGAA
TGGATCTCTCCTGCTTTCTGCTTGTGGTTCATAGGCCATAATCGAATGTGGAGAAAGAACCGTTCTTTC
TATGCGAACAATCATTGCATCGGAACAGACCTGAATAGGAACTTTGCTTCCAAACACTGGTGTGAGGAA
GGTGCATCCAGTTCCTCATGCTCGGAAACCTACTGTGGACTTTATCCTGAGTCAGAACCAGAAGTGAAG
GCAGTGGCTAGTTTCTTGAGAAGAAATATCAACCAGATTAAAGCATACATCAGCATGCATTCATACTCC
CAGCATATAGTGTTTCCATATTCCTATACACGAAGTAAAAGCAAAGACCATGAGGAACTGTCTCTAGTA
GCCAGTGAAGCAGTTCGTGCTATTGAGAAAATTAGTAAAAATACCAGGTATACACATGGCCATGGCTCA
GAAACCTTATACCTAGCTCCTGGAGGTGGGGACGATTGGATCTATGATTTGGGCATCAAATATTCGTTT
ACAATTGAACTTCGAGATACGGGCACATACGGATTCTTGCTGCCGGAGCGTTACATCAAACCCACCTGT
AGAGAAGCTTTTGCCGCTGTCTCTAAAATAGCTTGGCATGTCATTAGGAATGTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278541
Insert Size 1161 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278541.1
RefSeq Size 1655 bp
RefSeq ORF 1161 bp
Locus ID 1361
UniProt ID Q96IY4
Protein Families Druggable Genome, Protease, Secreted Protein
Protein Pathways Complement and coagulation cascades
MW 44 kDa
Gene Summary Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). The protein encoded by this gene is activated by trypsin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. Polymorphisms have been described for this gene and its promoter region. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the central coding region compared to variant 1. It encodes isoform 2 which is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...