Cytochrome P450 3A5 (CYP3A5) (NM_001291829) Human Untagged Clone

CAT#: SC335807

CYP3A5 (untagged) - Human cytochrome P450, family 3, subfamily A, polypeptide 5 (CYP3A5), transcript variant 4



  "NM_001291829" in other vectors (2)

CNY 3710.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CYP3A5 rabbit polyclonal antibody
    • 100 ul

CNY 1999.00
CNY 3280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CP35; CYPIIIA5; P450PCN3; PCN3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC335807 representing NM_001291829.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAAAAGTGCCATCTCTTTAGCTGAGGATGAAGAATGGAAGAGAATACGGTCATTGCTGTCTCCAACC
TTCACCAGCGGAAAACTCAAGGAGATGTTCCCCATCATTGCCCAGTATGGAGATGTATTGGTGAGAAAC
TTGAGGCGGGAAGCAGAGAAAGGCAAGCCTGTCACCTTGAAAGACATCTTTGGGGCCTACAGCATGGAT
GTGATTACTGGCACATCATTTGGAGTGAACATCGACTCTCTCAACAATCCACAAGACCCCTTTGTGGAG
AGCACTAAGAAGTTCCTAAAATTTGGTTTCTTAGATCCATTATTTCTCTCAATAATACTCTTTCCATTC
CTTACCCCAGTTTTTGAAGCATTAAATGTCTCTCTGTTTCCAAAAGATACCATAAATTTTTTAAGTAAA
TCTGTAAACAGAATGAAGAAAAGTCGCCTCAACGACAAACAAAAGCACCGACTAGATTTCCTTCAGCTG
ATGATTGACTCCCAGAATTCGAAAGAAACTGAGTCCCACAAAGCTCTGTCTGATCTGGAGCTCGCAGCC
CAGTCAATAATCTTCATTTTTGCTGGCTATGAAACCACCAGCAGTGTTCTTTCCTTCACTTTATATGAA
CTGGCCACTCACCCTGATGTCCAGCAGAAACTGCAAAAGGAGATTGATGCAGTTTTGCCCAATAAGGCA
CCACCTACCTATGATGCCGTGGTACAGATGGAGTACCTTGACATGGTGGTGAATGAAACACTCAGATTA
TTCCCAGTTGCTATTAGACTTGAGAGGACTTGCAAGAAAGATGTTGAAATCAATGGGGTATTCATTCCC
AAAGGGTCAATGGTGGTGATTCCAACTTATGCTCTTCACCATGACCCAAAGTACTGGACAGAGCCTGAG
GAGTTCCGCCCTGAAAGGTTCAGTAAGAAGAAGGACAGCATAGATCCTTACATATACACACCCTTTGGA
ACTGGACCCAGAAACTGCATTGGCATGAGGTTTGCTCTCATGAACATGAAACTTGCTCTAATCAGAGTC
CTTCAGAACTTCTCCTTCAAACCTTGTAAAGAAACACAGATCCCCTTGAAATTAGACACGCAAGGACTT
CTTCAACCAGAAAAACCCATTGTTCTAAAGGTGGATTCAAGAGATGGAACCCTAAGTGGAGAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001291829
Insert Size 1170 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001291829.1
RefSeq Size 2255 bp
RefSeq ORF 1170 bp
Locus ID 1577
Protein Families Druggable Genome, P450, Transmembrane
Protein Pathways Drug metabolism - cytochrome P450, Drug metabolism - other enzymes, Linoleic acid metabolism, Metabolic pathways, Metabolism of xenobiotics by cytochrome P450, Retinol metabolism
MW 44.3 kDa
Gene Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein metabolizes drugs as well as the steroid hormones testosterone and progesterone. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Two pseudogenes of this gene have been identified within this cluster on chromosome 7. Expression of this gene is widely variable among populations, and a single nucleotide polymorphism that affects transcript splicing has been associated with susceptibility to hypertensions. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (4) differs in its 5' UTR and uses a downstream start codon, compared to variant 1. The encoded isoform (3) has a shorter N-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...