SSB (NM_001294145) Human Untagged Clone

CAT#: SC335919

SSB (untagged) - Human Sjogren syndrome antigen B (autoantigen La) (SSB), transcript variant 2



  "NM_001294145" in other vectors (2)

CNY 3900.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Anti-SSB mouse monoclonal antibody, clone OTI1E11 (formerly 1E11)
    • 100 ul

CNY 1999.00
CNY 2700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms La; La/SSB; LARP3
Vector pCMV6-Entry
Sequence Data
>SC335919 representing NM_001294145.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCTGAAAATGGTGATAATGAAAAGATGGCTGCCCTGGAGGCCAAAATCTGTCATCAAATTGAGTAT
TATTTTGGCGACTTCAATTTGCCACGGGACAAGTTTCTAAAGGAACAGATAAAACTGGATGAAGGCTGG
GTACCTTTGGAGATAATGATAAAATTCAACAGGTTGAACCGTCTAACAACAGACTTTAATGTAATTGTG
GAAGCATTGAGCAAATCCAAGGCAGAACTCATGGAAATCAGTGAAGATAAAACTAAAATCAGAAGGTCT
CCAAGCAAACCCCTACCTGAAGTGACTGATGAGTATAAAAATGATGTAAAAAACAGATCTGTTTATATT
AAAGGCTTCCCAACTGATGCAACTCTTGATGACATAAAAGAATGGTTAGAAGATAAAGGTCAAGTACTA
AATATTCAGATGAGAAGAACATTGCATAAAGCATTTAAGGGATCAATTTTTGTTGTGTTTGATAGCATT
GAATCTGCTAAGAAATTTGTAGAGACCCCTGGCCAGAAGTACAAAGAAACAGACCTGCTAATACTTTTC
AAGGACGATTACTTTGCCAAAAAAAATGAAGAAAGAAAACAAAATAAAGTGGAAGCTAAATTAAGAGCT
AAACAGGAGCAAGAAGCAAAACAAAAGTTAGAAGAAGATGCTGAAATGAAATCTCTAGAAGAAAAGATT
GGATGCTTGCTGAAATTTTCGGGTGATTTAGATGATCAGACCTGTAGAGAAGATTTACACATACTTTTC
TCAAATCATGGTGAAATAAAATGGATAGACTTCGTCAGAGGAGCAAAAGAGGGGATAATTCTATTTAAA
GAAAAAGCCAAGGAAGCATTGGGTAAAGCCAAAGATGCAAATAATGGTAACCTACAATTAAGGAACAAA
GAAGTGACTTGGGAAGTACTAGAAGGAGAGGTGGAAAAAGAAGCACTGAAGAAAATAATAGAAGACCAA
CAAGAATCCCTAAACAAATGGAAGTCAAAAGGTCGTAGATTTAAAGGAAAAGGAAAGGGTAATAAAGCT
GCCCAGCCTGGGTCTGGTAAAGGAAAAGTACAGTTTCAGGGCAAGAAAACGAAATTTGCTAGTGATGAT
GAACATGATGAACATGATGAAAATGGTGCAACTGGACCTGTGAAAAGAGCAAGAGAAGAAACAGACAAA
GAAGAACCTGCATCCAAACAACAGAAAACAGAAAATGGTGCTGGAGACCAGTAG

Restriction Sites SgfI-MluI     
ACCN NM_001294145
Insert Size 1227 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001294145.1
RefSeq Size 2043 bp
RefSeq ORF 1227 bp
Locus ID 6741
UniProt ID P05455
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Systemic lupus erythematosus
MW 46.8 kDa
Gene Summary The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
Transcript Variant: This variant (2) has an alternate 5' UTR exon and encodes the same protein, compared to variant 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...