LILRB1 (NM_001278399) Human Untagged Clone

CAT#: SC336227

LILRB1 (untagged) - Human leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1 (LILRB1), transcript variant 6



  "NM_001278399" in other vectors (2)

CNY 4370.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (4)
Rabbit Polyclonal Anti-LILRB1 Antibody
    • 100 ul

CNY 1999.00
CNY 3280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD85J; ILT-2; ILT2; LIR-1; LIR1; MIR-7; MIR7; PIR-B; PIRB
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC336227 representing NM_001278399.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCCCCATCCTCACGGTCCTGATCTGTCTCGGGCTGAGTCTGGGCCCCCGGACCCACGTGCAGGCA
GGGCACCTCCCCAAGCCCACCCTCTGGGCTGAACCAGGCTCTGTGATCACCCAGGGGAGTCCTGTGACC
CTCAGGTGTCAGGGGGGCCAGGAGACCCAGGAGTACCGTCTATATAGAGAAAAGAAAACAGCACCCTGG
ATTACACGGATCCCACAGGAGCTTGTGAAGAAGGGCCAGTTCCCCATCCCATCCATCACCTGGGAACAC
ACAGGGCGGTATCGCTGTTACTATGGTAGCGACACTGCAGGCCGCTCAGAGAGCAGTGACCCCCTGGAG
CTGGTGGTGACAGGAGCCTACATCAAACCCACCCTCTCAGCCCAGCCCAGCCCCGTGGTGAACTCAGGA
GGGAATGTAACCCTCCAGTGTGACTCACAGGTGGCATTTGATGGCTTCATTCTGTGTAAGGAAGGAGAA
GATGAACACCCACAATGCCTGAACTCCCAGCCCCATGCCCGTGGGTCGTCCCGCGCCATCTTCTCCGTG
GGCCCCGTGAGCCCGAGTCGCAGGTGGTGGTACAGGTGCTATGCTTATGACTCGAACTCTCCCTATGAG
TGGTCTCTACCCAGTGATCTCCTGGAGCTCCTGGTCCTAGGTGTTTCTAAGAAGCCATCACTCTCAGTG
CAGCCAGGTCCTATCGTGGCCCCTGAGGAGACCCTGACTCTGCAGTGTGGCTCTGATGCTGGCTACAAC
AGATTTGTTCTGTATAAGGACGGGGAACGTGACTTCCTTCAGCTCGCTGGCGCACAGCCCCAGGCTGGG
CTCTCCCAGGCCAACTTCACCCTGGGCCCTGTGAGCCGCTCCTACGGGGGCCAGTACAGATGCTACGGT
GCACACAACCTCTCCTCCGAGTGGTCGGCCCCCAGCGACCCCCTGGACATCCTGATCGCAGGACAGTTC
TATGACAGAGTCTCCCTCTCGGTGCAGCCGGGCCCCACGGTGGCCTCAGGAGAGAACGTGACCCTGCTG
TGTCAGTCACAGGGATGGATGCAAACTTTCCTTCTGACCAAGGAGGGGGCAGCTGATGACCCATGGCGT
CTAAGATCAACGTACCAATCTCAAAAATACCAGGCTGAATTCCCCATGGGTCCTGTGACCTCAGCCCAT
GCGGGGACCTACAGGTGCTACGGCTCACAGAGCTCCAAACCCTACCTGCTGACTCACCCCAGTGACCCC
CTGGAGCTCGTGGTCTCAGGACCGTCTGGGGGCCCCAGCTCCCCGACAACAGGCCCCACCTCCACATCT
GCAGGCCCTGAGGACCAGCCCCTCACCCCCACCGGGTCGGATCCCCAGAGTGGTGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001278399
Insert Size 1371 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001278399.2
RefSeq Size 1690 bp
RefSeq ORF 1371 bp
Locus ID 10859
UniProt ID Q8NHL6
Protein Families Transmembrane
MW 49.4 kDa
Gene Summary This gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family, which is found in a gene cluster at chromosomal region 19q13.4. The encoded protein belongs to the subfamily B class of LIR receptors which contain two or four extracellular immunoglobulin domains, a transmembrane domain, and two to four cytoplasmic immunoreceptor tyrosine-based inhibitory motifs (ITIMs). The receptor is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (6) has a shorter 5' UTR, lacks several exons, and its 3'-terminal exon extends past a splice site that is used in variant 1. The resulting protein (isoform 6) has a shorter and distinct C-terminus, compared to isoform 1. Isoform 6 lacks the transmembrane domain found in isoform 1 and is suspected to be soluble (PMID: 19658091). Sequence Note: A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species and on the presence of a predicted signal peptide in the protein N-terminus. An upstream in-frame start codon is also present but is only conserved in primates, and use of the upstream start codon would result in a protein that is 17 aa longer at the N-terminus and lacks a predicted signal peptide. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...