Human PIGBOS1 activation kit by CRISPRa

Specifications

Product Data
Format	3 gRNAs (5ug each), 1 scramble ctrl (10ug) and 1 enhancer vector (10ug)
Symbol	PIGBOS1
Locus ID	101928527
Kit Components	GA119487G1, PIGBOS1 gRNA vector 1 in pCas-Guide-GFP-CRISPRa, Target Sequence: CTCCTGGGTGTTGAAGTACA GA119487G2, PIGBOS1 gRNA vector 2 in pCas-Guide-GFP-CRISPRa, Target Sequence: TACCTTGTACTTCAACACCC GA119487G3, PIGBOS1 gRNA vector 3 in pCas-Guide-GFP-CRISPRa, Target Sequence: GCTCGTCCATCCATTAAGTT 1 CRISPRa-Enhancer vector, SKU GE100056 1 CRISPRa scramble vector, SKU GE100077
Reference Data
RefSeq	NM_001308421, NM_001308422, NM_001308423
Summary	Plays a role in regulation of the unfolded protein response triggered by endoplasmic reticulum (ER) stress resulting from the presence of unfolded proteins in the ER lumen.[UniProtKB/Swiss-Prot Function]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.