FGFR4 Human Gene Knockout Kit (CRISPR)

CAT#: KN204230LP

FGFR4 - human gene knockout kit via CRISPR, HDR mediated




 HDR-mediated knockout kit validation

  See Other Versions

CNY 12260.00


货期*
6周

规格
    • 1 kit

Product images

推荐一起购买 (3)
pCAS-Scramble, pCas-Guide vector with a scrambled sequence as a negative control (10 µg)
    • 10 ug

CNY 3710.00


Rabbit polyclonal FGFR4 Antibody (N-term)
    • 200 ul

CNY 6160.00


FGFR4 (Myc-DDK-tagged)-Human fibroblast growth factor receptor 4 (FGFR4), transcript variant 1
    • 10 ug

CNY 8808.00

Specifications

Product Data
Format 2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA Luciferase-Puro
Symbol FGFR4
UniProt ID P22455
Locus ID 2264
Kit Components

KN204230G1, FGFR4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTAGGAAGCTGGCAATCTCT

KN204230G2, FGFR4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AATCTCACCTTGATTACAGG

KN204230LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette.

GE100003, scramble sequence in pCas-Guide vector

Reference Data
RefSeq NM_001291980, NM_002011, NM_022963, NM_213647, NM_001354984
Synonyms CD334; JTK2; TKF
Summary The protein encoded by this gene is a tyrosine kinase and cell surface receptor for fibroblast growth factors. The encoded protein is involved in the regulation of several pathways, including cell proliferation, cell differentiation, cell migration, lipid metabolism, bile acid biosynthesis, vitamin D metabolism, glucose uptake, and phosphate homeostasis. This protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. [provided by RefSeq, Aug 2017]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Other Versions

Customer Reviews 
Loading...