FGFR4 Human Gene Knockout Kit (CRISPR)

Specifications

Product Data
Format	2 gRNA vectors, 1 Luciferase-Puro donor, 1 scramble control
Donor DNA	Luciferase-Puro
Symbol	FGFR4
Locus ID	2264
Kit Components	KN204230G1, FGFR4 gRNA vector 1 in pCas-Guide CRISPR vector, Target Sequence: GTAGGAAGCTGGCAATCTCT KN204230G2, FGFR4 gRNA vector 2 in pCas-Guide CRISPR vector, Target Sequence: AATCTCACCTTGATTACAGG KN204230LP-D, donor DNA containing left and right homologous arms and Luciferase-Puro functional cassette. GE100003, scramble sequence in pCas-Guide vector
Reference Data
RefSeq	NM_001291980, NM_002011, NM_022963, NM_213647, NM_001354984
Synonyms	CD334; JTK2; TKF
Summary	The protein encoded by this gene is a tyrosine kinase and cell surface receptor for fibroblast growth factors. The encoded protein is involved in the regulation of several pathways, including cell proliferation, cell differentiation, cell migration, lipid metabolism, bile acid biosynthesis, vitamin D metabolism, glucose uptake, and phosphate homeostasis. This protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment, and a cytoplasmic tyrosine kinase domain. The extracellular portion interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. [provided by RefSeq, Aug 2017]

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.