DHDH (NM_014475) Human 3' UTR Clone

CAT#: SC200028

3' UTR clone of dihydrodiol dehydrogenase (dimeric) (DHDH) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DHDH (NM_014475) Human 3' UTR Clone
Vector pMirTarget
Synonyms 2DD; HUM2DD
ACCN NM_014475
Insert Size 66 bp
Sequence Data
>SC200028 3’UTR clone of NM_014475
The sequence shown below is from the reference sequence of NM_014475. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGAGTCACCTTCCCCCAAGACAAACGCTGATGTATCCCCGAATAAATAAAGACATCTTACATCTTC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_014475.4
Synonyms 2DD; HUM2DD
Summary This gene encodes an enzyme that belongs to the family of dihydrodiol dehydrogenases, which exist in multiple forms in mammalian tissues and are involved in the metabolism of xenobiotics and sugars. These enzymes catalyze the NADP1-linked oxidation of transdihydrodiols of aromatic hydrocarbons to corresponding catechols. This enzyme is a dimeric dihydrodiol dehydrogenase, and it differs from monomeric dihydrodiol dehydrogenases in its high substrate specificity for trans-dihydrodiols of aromatic hydrocarbons in the oxidative direction. [provided by RefSeq, Jul 2008]
Locus ID 27294
MW 2.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...