RENBP (NM_002910) Human 3' UTR Clone

CAT#: SC200035

3' UTR clone of renin binding protein (RENBP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RENBP (NM_002910) Human 3' UTR Clone
Vector pMirTarget
Synonyms RBP; RNBP
ACCN NM_002910
Insert Size 47 bp
Sequence Data
>SC200035 3’UTR clone of NM_002910
The sequence shown below is from the reference sequence of NM_002910. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCACCCCCGCCTGCCGAGGCGCGGAATAAAGGCTGAGTCCGCTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002910.6
Synonyms RBP; RNBP
Summary The gene product inhibits renin activity by forming a dimer with renin, a complex known as high molecular weight renin. The encoded protein contains a leucine zipper domain, which is essential for its dimerization with renin. The gene product can catalyze the interconversion of N-acetylglucosamine to N-acetylmannosamine, indicating that it is a GlcNAc 2-epimerase. Transcript variants utilizing alternative promoters have been described in the literature. [provided by RefSeq, Jul 2008]
Locus ID 5973
MW 1.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...