MVP (NM_005115) Human 3' UTR Clone

CAT#: SC200056

3' UTR clone of major vault protein (MVP) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MVP (NM_005115) Human 3' UTR Clone
Vector pMirTarget
Synonyms LRP; VAULT1
ACCN NM_005115
Insert Size 62 bp
Sequence Data
>SC200056 3’UTR clone of NM_005115
The sequence shown below is from the reference sequence of NM_005115. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACAACCACGTGGTGCCTGTACTGCGCTAACTCCTGATTAATACAATGGAAGTTTCTGGGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005115.5
Synonyms LRP; VAULT1
Summary This gene encodes the major component of the vault complex. Vaults are multi-subunit ribonucleoprotein structures that may be involved in nucleo-cytoplasmic transport. The encoded protein may play a role in multiple cellular processes by regulating the MAP kinase, JAK/STAT and phosphoinositide 3-kinase/Akt signaling pathways. The encoded protein also plays a role in multidrug resistance, and expression of this gene may be a prognostic marker for several types of cancer. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
Locus ID 9961
MW 2.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...