BCS1L (NM_004328) Human 3' UTR Clone

CAT#: SC200079

3' UTR clone of BCS1-like (yeast) (BCS1L) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BCS1L (NM_004328) Human 3' UTR Clone
Vector pMirTarget
Synonyms BCS; BCS1; BJS; FLNMS; GRACILE; h-BCS; h-BCS1; Hs.6719; MC3DN1; PTD
ACCN NM_004328
Insert Size 87 bp
Sequence Data
>SC200079 3’UTR clone of NM_004328
The sequence shown below is from the reference sequence of NM_004328. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATTCACAATGCTGAGTCTCTGAGGAGGTGATCAGGCTGGGCTCAGCTCAGCTCTCCTCCTCTAGCTCAA
TAAACATCTGCCACACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004328.5
Synonyms BCS; BCS1; BJS; FLNMS; GRACILE; h-BCS; h-BCS1; Hs.6719; MC3DN1; PTD
Summary This gene encodes a homolog of the S. cerevisiae bcs1 protein which is involved in the assembly of complex III of the mitochondrial respiratory chain. The encoded protein does not contain a mitochondrial targeting sequence but experimental studies confirm that it is imported into mitochondria. Mutations in this gene are associated with mitochondrial complex III deficiency and the GRACILE syndrome. Several alternatively spliced transcripts encoding two different isoforms have been described. [provided by RefSeq, Jan 2016]
Locus ID 617
MW 3.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...