RPL5 (NM_000969) Human 3' UTR Clone

CAT#: SC200153

3' UTR clone of ribosomal protein L5 (RPL5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL5 (NM_000969) Human 3' UTR Clone
Vector pMirTarget
Synonyms L5; MSTP030; PPP1R135; uL18
ACCN NM_000969
Insert Size 89 bp
Sequence Data
>SC200153 3’UTR clone of NM_000969
The sequence shown below is from the reference sequence of NM_000969. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGAGCTCAGGAGCGGGCTGCTGAGAGCTAAACCCAGCAATTTTCTATGATTTTTTCAGATATAGATAAT
AAACTTATGAACAGCAACTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000969.5
Synonyms L5; MSTP030; PPP1R135; uL18
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of four RNA species and approximately 80 structurally distinct proteins. This gene encodes a member of the L18P family of ribosomal proteins and component of the 60S subunit. The encoded protein binds 5S rRNA to form a stable complex called the 5S ribonucleoprotein particle (RNP), which is necessary for the transport of nonribosome-associated cytoplasmic 5S rRNA to the nucleolus for assembly into ribosomes. The encoded protein may also function to inhibit tumorigenesis through the activation of downstream tumor suppressors and the downregulation of oncoprotein expression. Mutations in this gene have been identified in patients with Diamond-Blackfan Anemia (DBA). This gene is co-transcribed with the small nucleolar RNA gene U21, which is located in its fifth intron. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed throughout the genome. [provided by RefSeq, Mar 2017]
Locus ID 6125
MW 3.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...