RACK1 (NM_006098) Human 3' UTR Clone

CAT#: SC200179

3' UTR clone of guanine nucleotide binding protein (G protein) beta polypeptide 2-like 1 (GNB2L1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RACK1 (NM_006098) Human 3' UTR Clone
Vector pMirTarget
Synonyms Gnb2-rs1; GNB2L1; H12.3; HLC-7; PIG21
ACCN NM_006098
Insert Size 110 bp
Sequence Data
>SC200179 3’UTR clone of NM_006098
The sequence shown below is from the reference sequence of NM_006098. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTGTGGCAGGTGACCATTGGCACACGCTAGAAGTTTATGGCAGAGCTTTACAAATAAAAAAAAAACTGG
CTTTTCTGACTTTTAGGTTTTTTTTTCTTATATGCAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_006098.5
Synonyms Gnb2-rs1; GNB2L1; H12.3; HLC-7; PIG21
Summary Scaffolding protein involved in the recruitment, assembly and/or regulation of a variety of signaling molecules. Interacts with a wide variety of proteins and plays a role in many cellular processes. Component of the 40S ribosomal subunit involved in translational repression (PubMed:23636399). Involved in the initiation of the ribosome quality control (RQC), a pathway that takes place when a ribosome has stalled during translation, by promoting ubiquitination of a subset of 40S ribosomal subunits (PubMed:28132843). Binds to and stabilizes activated protein kinase C (PKC), increasing PKC-mediated phosphorylation. May recruit activated PKC to the ribosome, leading to phosphorylation of EIF6. Inhibits the activity of SRC kinases including SRC, LCK and YES1. Inhibits cell growth by prolonging the G0/G1 phase of the cell cycle. Enhances phosphorylation of BMAL1 by PRKCA and inhibits transcriptional activity of the BMAL1-CLOCK heterodimer. Facilitates ligand-independent nuclear translocation of AR following PKC activation, represses AR transactivation activity and is required for phosphorylation of AR by SRC. Modulates IGF1R-dependent integrin signaling and promotes cell spreading and contact with the extracellular matrix. Involved in PKC-dependent translocation of ADAM12 to the cell membrane. Promotes the ubiquitination and proteasome-mediated degradation of proteins such as CLEC1B and HIF1A. Required for VANGL2 membrane localization, inhibits Wnt signaling, and regulates cellular polarization and oriented cell division during gastrulation. Required for PTK2/FAK1 phosphorylation and dephosphorylation. Regulates internalization of the muscarinic receptor CHRM2. Promotes apoptosis by increasing oligomerization of BAX and disrupting the interaction of BAX with the anti-apoptotic factor BCL2L. Inhibits TRPM6 channel activity. Regulates cell surface expression of some GPCRs such as TBXA2R. Plays a role in regulation of FLT1-mediated cell migration. Involved in the transport of ABCB4 from the Golgi to the apical bile canalicular membrane (PubMed:19674157). Promotes migration of breast carcinoma cells by binding to and activating RHOA (PubMed:20499158).[UniProtKB/Swiss-Prot Function]
Locus ID 10399
MW 4.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...