IRS4 (NM_003604) Human 3' UTR Clone

CAT#: SC200276

3' UTR clone of insulin receptor substrate 4 (IRS4) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IRS4 (NM_003604) Human 3' UTR Clone
Vector pMirTarget
Synonyms CHNG9; IRS-4; PY160
ACCN NM_003604
Insert Size 104 bp
Sequence Data
>SC200276 3’UTR clone of NM_003604
The sequence shown below is from the reference sequence of NM_003604. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAGTTCGACTCTCCCAAAAGAGGTCGGTAATTTTAGAATTAATTTCCCTAAAGTGAATGGTCATTGTCT
AATGATTCGATGCGCTACAGTCTACAGTGTTAGGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003604.2
Synonyms CHNG9; IRS-4; PY160
Summary IRS4 encodes the insulin receptor substrate 4, a cytoplasmic protein that contains many potential tyrosine and serine/threonine phosphorylation sites. Tyrosine-phosphorylated IRS4 protein has been shown to associate with cytoplasmic signalling molecules that contain SH2 domains. The IRS4 protein is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation.. [provided by RefSeq, Jul 2008]
Locus ID 8471
MW 4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...