IRF3 (NM_001571) Human 3' UTR Clone

CAT#: SC200318

3' UTR clone of interferon regulatory factor 3 (IRF3) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IRF3 (NM_001571) Human 3' UTR Clone
Vector pMirTarget
Synonyms IIAE7
ACCN NM_001571
Insert Size 106 bp
Sequence Data
>SC200318 3’UTR clone of NM_001571
The sequence shown below is from the reference sequence of NM_001571. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATGGATTTCCAGGGCCCTGGGGAGAGCTGAGCCCTCGCTCCTCATGGTGTGCCTCCAACCCCCCTGTTC
CCCACCACCTCAACCAATAAACTGGTTCCTGCTATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001571.6
Synonyms IIAE7
Summary This gene encodes a member of the interferon regulatory transcription factor (IRF) family. The encoded protein is found in an inactive cytoplasmic form that upon serine/threonine phosphorylation forms a complex with CREBBP. This complex translocates to the nucleus and activates the transcription of interferons alpha and beta, as well as other interferon-induced genes. The protein plays an important role in the innate immune response against DNA and RNA viruses. Mutations in this gene are associated with Encephalopathy, acute, infection-induced, herpes-specific, 7. [provided by RefSeq, Sep 2020]
Locus ID 3661
MW 3.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...