ISG15 (NM_005101) Human 3' UTR Clone

CAT#: SC200355

3' UTR clone of ISG15 ubiquitin-like modifier (ISG15) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ISG15 (NM_005101) Human 3' UTR Clone
Vector pMirTarget
Synonyms G1P2; hUCRP; IFI15; IMD38; IP17; UCRP
ACCN NM_005101
Insert Size 92 bp
Sequence Data
>SC200355 3’UTR clone of NM_005101
The sequence shown below is from the reference sequence of NM_005101. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCGGCACAGAGCCTGGCGGGCGGAGCTAAGGGCCTCCACCAGCATCCGAGCAGGATCAAGGGCCGGAA
ATAAAGGCTGTTGTAAAGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005101.4
Synonyms G1P2; hUCRP; IFI15; IMD38; IP17; UCRP
Summary The protein encoded by this gene is a ubiquitin-like protein that is conjugated to intracellular target proteins upon activation by interferon-alpha and interferon-beta. Several functions have been ascribed to the encoded protein, including chemotactic activity towards neutrophils, direction of ligated target proteins to intermediate filaments, cell-to-cell signaling, and antiviral activity during viral infections. While conjugates of this protein have been found to be noncovalently attached to intermediate filaments, this protein is sometimes secreted. [provided by RefSeq, Dec 2012]
Locus ID 9636
MW 3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...