SMARCAL1 (NM_001127207) Human 3' UTR Clone

CAT#: SC200428

3' UTR clone of SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily a-like 1 (SMARCAL1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SMARCAL1 (NM_001127207) Human 3' UTR Clone
Vector pMirTarget
Synonyms HARP; HHARP
ACCN NM_001127207
Insert Size 106 bp
Sequence Data
>SC200428 3’UTR clone of NM_001127207
The sequence shown below is from the reference sequence of NM_001127207. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AACTGGGACAGCTTTACGTCTCCCCTGTAAAAGGGGCAAAAAGAAAAAAATAAAAAGCATTTTAAAATC
ATGGAATTGAAATAAAATAATGTATTTTGTTTTAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001127207.2
Synonyms HARP; HHARP
Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein shows sequence similarity to the E. coli RNA polymerase-binding protein HepA. Mutations in this gene are a cause of Schimke immunoosseous dysplasia (SIOD), an autosomal recessive disorder with the diagnostic features of spondyloepiphyseal dysplasia, renal dysfunction, and T-cell immunodeficiency. [provided by RefSeq, Jul 2008]
Locus ID 50485
MW 4.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...