EPB42 (NM_001114134) Human 3' UTR Clone

CAT#: SC200447

3' UTR clone of erythrocyte membrane protein band 4.2 (EPB42) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name EPB42 (NM_001114134) Human 3' UTR Clone
Vector pMirTarget
Synonyms PA; SPH5
ACCN NM_001114134
Insert Size 105 bp
Sequence Data
>SC200447 3’UTR clone of NM_001114134
The sequence shown below is from the reference sequence of NM_001114134. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACCGTGGTAGCCCCTGAACTATCAGCTTAAACTTCCAGCTCTATCACCACTCTCCTGCCAACCCTTGTT
CTACAATCTAAACCAAACATGTGCTAGGAAGAGAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001114134.2
Synonyms PA; SPH5
Summary Erythrocyte membrane protein band 4.2 is an ATP-binding protein which may regulate the association of protein 3 with ankyrin. It probably has a role in erythrocyte shape and mechanical property regulation. Mutations in the EPB42 gene are associated with recessive spherocytic elliptocytosis and recessively transmitted hereditary hemolytic anemia. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 2038
MW 3.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...