CDKL5 (NM_001037343) Human 3' UTR Clone

CAT#: SC200454

3' UTR clone of cyclin-dependent kinase-like 5 (CDKL5) transcript variant II for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CDKL5 (NM_001037343) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFAP247; DEE2; EIEE2; ISSX; STK9
ACCN NM_001037343
Insert Size 115 bp
Sequence Data
>SC200454 3’UTR clone of NM_001037343
The sequence shown below is from the reference sequence of NM_001037343. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CATGAGAATGCGGCACTGACGGGCAAGTGACTTCTGCAAGCCTGCGGCTGGTCCCAATGCCCTGAATCA
CCTCTCTCATGGAAGAACCAATTAACACCAATGAATCAACCATTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001037343.2
Synonyms CFAP247; DEE2; EIEE2; ISSX; STK9
Summary This gene is a member of Ser/Thr protein kinase family and encodes a phosphorylated protein with protein kinase activity. Mutations in this gene have been associated with X-linked infantile spasm syndrome (ISSX), also known as X-linked West syndrome, and Rett syndrome (RTT). Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Locus ID 6792
MW 4.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...