NACAD (NM_001146334) Human 3' UTR Clone

CAT#: SC200458

3' UTR clone of NAC alpha domain containing (NACAD) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name NACAD (NM_001146334) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_001146334
Insert Size 102 bp
Sequence Data
>SC200458 3’UTR clone of NM_001146334
The sequence shown below is from the reference sequence of NM_001146334. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GTCAACGCCATCATGGAACTGACCATGTAGCCACTGACCGGAAGCTGGAGCCATCCTACGCCTTCCCTC
AGCTCTGCTACTCAATAAATCGGTGTCCCTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001146334.2
Summary May prevent inappropriate targeting of non-secretory polypeptides to the endoplasmic reticulum (ER). May bind to nascent polypeptide chains as they emerge from the ribosome and block their interaction with the signal recognition particle (SRP), which normally targets nascent secretory peptides to the ER. May also reduce the inherent affinity of ribosomes for protein translocation sites in the ER membrane (M sites) (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 23148
MW 3.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...