SETD4 (NM_001007259) Human 3' UTR Clone

CAT#: SC200491

3' UTR clone of SET domain containing 4 (SETD4) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SETD4 (NM_001007259) Human 3' UTR Clone
Vector pMirTarget
Synonyms C21orf18; C21orf27
ACCN NM_001007259
Insert Size 105 bp
Sequence Data
>SC200491 3’UTR clone of NM_001007259
The sequence shown below is from the reference sequence of NM_001007259. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCAAGAGGTTGGAATCAACTTTGTTCTTAACATTAACACTATATAATTTTTTTCCCCATTTGGAGATGT
GTATTTTCAGTTTTAATAAAAATATCAAAACCTTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001007259.3
Synonyms C21orf18; C21orf27
Summary Histone-lysine N-methyltransferase that acts as a regulator of cell proliferation, cell differentiation and inflammatory response (PubMed:31308046). Regulates the inflammatory response by mediating mono- and dimethylation of 'Lys-4' of histone H3 (H3K4me1 and H3K4me2, respectively), leading to activate the transcription of proinflammatory cytokines IL6 and TNF-alpha (By similarity). Also involved in the regulation of stem cell quiescence by catalyzing the trimethylation of 'Lys-20' of histone H4 (H4K20me3), thereby promoting heterochromatin formation (PubMed:31308046). Involved in proliferation, migration, paracrine and myogenic differentiation of bone marrow mesenchymal stem cells (BMSCs) (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 54093
MW 4.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...