MTERFD1 (MTERF3) (NM_015942) Human 3' UTR Clone

CAT#: SC200499

3' UTR clone of MTERF domain containing 1 (MTERFD1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MTERFD1 (MTERF3) (NM_015942) Human 3' UTR Clone
Vector pMirTarget
Synonyms CGI-12; MTERFD1
ACCN NM_015942
Insert Size 119 bp
Sequence Data
>SC200499 3’UTR clone of NM_015942
The sequence shown below is from the reference sequence of NM_015942. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACTTTGAAAAATTCTTAAAAACGCTTTAGATTTTTATGTATGTTAAAATGCAGTATTGTAAAGTGAAT
ATATATATGAATAAATGAATATATTTTTAAATGCCTCGGGTCTCAACTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015942.5
Synonyms CGI-12; MTERFD1
Summary Binds promoter DNA and regulates initiation of transcription (PubMed:17662942). Required for normal mitochondrial transcription and translation, and for normal assembly of mitochondrial respiratory complexes. Required for normal mitochondrial function (By similarity). Maintains 16S rRNA levels and functions in mitochondrial ribosome assembly by regulating the biogenesis of the 39S ribosomal subunit (By similarity).[UniProtKB/Swiss-Prot Function]
Locus ID 51001
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...