Neutrophil Elastase (ELANE) (NM_001972) Human 3' UTR Clone

CAT#: SC200560

3' UTR clone of elastase neutrophil expressed (ELANE) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Neutrophil Elastase (ELANE) (NM_001972) Human 3' UTR Clone
Vector pMirTarget
Synonyms ELA2; GE; HLE; HNE; NE; PMN-E; SCN1
ACCN NM_001972
Insert Size 109 bp
Sequence Data
>SC200560 3’UTR clone of NM_001972
The sequence shown below is from the reference sequence of NM_001972. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACCCGGACCCGGCCAGCAGGACCCACTGAGAAGGGCTGCCCGGGTCACCTCAGCTGCCCACACCCACA
CTCTCCAGCATCTGGCACAATAAACATTCTCTGTTTTGTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001972.4
Synonyms ELA2; GE; HLE; HNE; NE; PMN-E; SCN1
Summary Elastases form a subfamily of serine proteases that hydrolyze many proteins in addition to elastin. Humans have six elastase genes which encode structurally similar proteins. The encoded preproprotein is proteolytically processed to generate the active protease. Following activation, this protease hydrolyzes proteins within specialized neutrophil lysosomes, called azurophil granules, as well as proteins of the extracellular matrix. The enzyme may play a role in degenerative and inflammatory diseases through proteolysis of collagen-IV and elastin. This protein also degrades the outer membrane protein A (OmpA) of E. coli as well as the virulence factors of such bacteria as Shigella, Salmonella and Yersinia. Mutations in this gene are associated with cyclic neutropenia and severe congenital neutropenia (SCN). This gene is present in a gene cluster on chromosome 19. [provided by RefSeq, Jan 2016]
Locus ID 1991
MW 3.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...