RPL7 (NM_000971) Human 3' UTR Clone

CAT#: SC200571

3' UTR clone of ribosomal protein L7 (RPL7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RPL7 (NM_000971) Human 3' UTR Clone
Vector pMirTarget
Synonyms humL7-1; L7
ACCN NM_000971
Insert Size 495 bp
Sequence Data
>SC200571 3’UTR clone of NM_000971
The sequence shown below is from the reference sequence of NM_000971. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ATCAACAGGCTTATTAGAAGAATGAACTAAGGTGTCTACCATGATTATTTTTCTAAGCTGGTTGGTTAA
TAAACAGTACCTGCTCTCAAATTGAAATATATTGTTGTATTTGTGATTTGTTGTTGTTGTTGTTAGCCT
GCCTCTGTCTTCCCTTAACTACTGTGGCAAGTGTGGTGTGTGATAAAATTAAGCCAAATCAACAGCCCA
TTTCGTGCAAAATCAGGGTCGAGTCTGTGTGAAAGACATCTCTTGGGTTTTTAAAAGGCTTTTCTATAC
AAAAGATTTTAATTTTTTGTTTTTTAACTGTGCTGAGTGATTCGAAATGGGTTTATTCTAAGAAAGCCT
GTTTCACAAGCATTTGTACATGATTTGTCGGTAAGGTAATCCAACTTTGGTTTATGGAAAAAATTGAAT
TTAGTTGCTAAAATTTATTTCTCGGGCCTTCGCTTGTTTATAAACTGCCATGTAAATGTGTTGTTTTCC
TTTTGCATTCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000971.4
Synonyms humL7-1; L7
Summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L30P family of ribosomal proteins. It contains an N-terminal basic region-leucine zipper (BZIP)-like domain and the RNP consensus submotif RNP2. In vitro the BZIP-like domain mediates homodimerization and stable binding to DNA and RNA, with a preference for 28S rRNA and mRNA. The protein can inhibit cell-free translation of mRNAs, suggesting that it plays a regulatory role in the translation apparatus. It is located in the cytoplasm. The protein has been shown to be an autoantigen in patients with systemic autoimmune diseases, such as systemic lupus erythematosus. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
Locus ID 6129
MW 19.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...