HBZ (NM_005332) Human 3' UTR Clone

CAT#: SC200674

3' UTR clone of hemoglobin zeta (HBZ) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name HBZ (NM_005332) Human 3' UTR Clone
Vector pMirTarget
Synonyms HBAZ; HBZ-T1; HBZ1
ACCN NM_005332
Insert Size 133 bp
Sequence Data
>SC200674 3’UTR clone of NM_005332
The sequence shown below is from the reference sequence of NM_005332. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCTCTGTCCTGACCGAGAAGTACCGCTGAGCGCCGCCTCCGGGACCCCCAGGACAGGCTGCGGCCCCT
CCCCCGTCCTGGAGGTTCCCCAGCCCCACTTACCGCGTAATGCGCCAATAAACCAATGAACGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005332.3
Synonyms HBAZ; HBZ-T1; HBZ1
Summary Zeta-globin is an alpha-like hemoglobin. The zeta-globin polypeptide is synthesized in the yolk sac of the early embryo, while alpha-globin is produced throughout fetal and adult life. The zeta-globin gene is a member of the human alpha-globin gene cluster that includes five functional genes and two pseudogenes. The order of genes is: 5' - zeta - pseudozeta - mu - pseudoalpha-1 - alpha-2 -alpha-1 - theta1 - 3'. [provided by RefSeq, Nov 2009]
Locus ID 3050
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...