ADRM1 (NM_007002) Human 3' UTR Clone

CAT#: SC200707

3' UTR clone of adhesion regulating molecule 1 (ADRM1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ADRM1 (NM_007002) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARM-1; ARM1; GP110; PSMD16
ACCN NM_007002
Insert Size 131 bp
Sequence Data
>SC200707 3’UTR clone of NM_007002
The sequence shown below is from the reference sequence of NM_007002. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GACGAAGAGGAGGACATGAGCCTGGACTGAGCCACGCGCCGTCCTCCGAGGAACTGGGCGCTTGCAGTG
CGTTGCACACCCTCACCTCCCACCCACTGATTATTAATAAAGTCTTTTCTTTTACCTGCCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_007002.4
Synonyms ARM-1; ARM1; GP110; PSMD16
Summary This gene encodes a member of the adhesion regulating molecule 1 protein family. The encoded protein is a component of the proteasome where it acts as a ubiquitin receptor and recruits the deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L5. Increased levels of the encoded protein are associated with increased cell adhesion, which is likely an indirect effect of this intracellular protein. Dysregulation of this gene has been implicated in carcinogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Locus ID 11047
MW 4.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...