BSCL2 (NM_001130702) Human 3' UTR Clone

CAT#: SC200788

3' UTR clone of Berardinelli-Seip congenital lipodystrophy 2 (seipin) (BSCL2) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name BSCL2 (NM_001130702) Human 3' UTR Clone
Vector pMirTarget
Synonyms GNG3LG; HMN5; HMN5C; PELD; SPG17
ACCN NM_001130702
Insert Size 326 bp
Sequence Data
>SC200788 3’UTR clone of NM_001130702
The sequence shown below is from the reference sequence of NM_001130702. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAGGAGAAACCAGATCAGCAGCCCCTGAGCGGAGAAGAGGAGCTAGAGCCTGAGGCCAGTGATGGTT
CAGGCTCCTGGGAAGATGCAGCTTTGCTGACGGAGGCCAACCTGCCTGCTCCTGCTCCTGCTTCTGCTT
CTGCCCCTGTCCTAGAGACTCTGGGCAGCTCTGAACCTGCTGGGGGTGCTCTCCGACAGCGCCCCACCT
GCTCTAGTTCCTGAAGAAAAGGGGCAGACTCCTCACATTCCAGCACTTTCCCACCTGACTCCTCTCCCC
TCGTTTTTCCTTCAATAAACTATTTTGTGTCAGCTTCTTCCTTGACTCTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001130702.2
Synonyms GNG3LG; HMN5; HMN5C; PELD; SPG17
Summary This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
Locus ID 26580
MW 12
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...