Apolipoprotein A II (APOA2) (NM_001643) Human 3' UTR Clone

CAT#: SC200814

3' UTR clone of apolipoprotein A-II (APOA2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Apolipoprotein A II (APOA2) (NM_001643) Human 3' UTR Clone
Vector pMirTarget
Synonyms Apo-AII; ApoA-II; apoAII
ACCN NM_001643
Insert Size 143 bp
Sequence Data
>SC200814 3’UTR clone of NM_001643
The sequence shown below is from the reference sequence of NM_001643. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAACTTGGAACACAGCCTGCCACCCAGTGAAGTGTCCAGACCATTGTCTTCCAACCCCAGCTGGCCTCT
AGAACACCCACTGGCCAGTCCTAGAGCTCCTGTCCCTACCCACTCTTTGCTACAATAAATGCTGAATGA
ATCCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001643.2
Synonyms Apo-AII; ApoA-II; apoAII
Summary This gene encodes apolipoprotein (apo-) A-II, which is the second most abundant protein of the high density lipoprotein particles. The protein is found in plasma as a monomer, homodimer, or heterodimer with apolipoprotein D. Defects in this gene may result in apolipoprotein A-II deficiency or hypercholesterolemia. [provided by RefSeq, Jul 2008]
Locus ID 336
MW 5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...