IFT122 (NM_052990) Human 3' UTR Clone

CAT#: SC200860

3' UTR clone of intraflagellar transport 122 homolog (Chlamydomonas) (IFT122) transcript variant 4 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name IFT122 (NM_052990) Human 3' UTR Clone
Vector pMirTarget
Synonyms CED; CED1; FAP80; SPG; WDR10; WDR10p; WDR140
ACCN NM_052990
Insert Size 272 bp
Sequence Data
>SC200860 3’UTR clone of NM_052990
The sequence shown below is from the reference sequence of NM_052990. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCAGGTGCAAGGATGACCCTGGCCCATGACCAGCATCCTGGGGACGGCCTGCACCCTCTGCCCGCCTT
GGGGTCTGCTGGGCTGTGAAGGAGAATAAAGAGTTAAACTGTCAGAATGTGTTTCTTGCCCAGATGAAG
TTTGTGTTTTGTGGGGGGGGCCTTGTGTAACCACGGAATTCCTATTTATGGCATTTCATGCCTTGTAAA
TAGCACCAGGAGATGAGGAAGAGAATGTACATATATTTTCTAAGGAAAAAAATCTGTTACTTTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_052990.3
Synonyms CED; CED1; FAP80; SPG; WDR10; WDR10p; WDR140
Summary This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This cytoplasmic protein contains seven WD repeats and an AF-2 domain which function by recruiting coregulatory molecules and in transcriptional activation. Mutations in this gene cause cranioectodermal dysplasia-1. A related pseudogene is located on chromosome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Locus ID 55764
MW 10.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...