DPP2 (DPP7) (NM_013379) Human 3' UTR Clone

CAT#: SC200986

3' UTR clone of dipeptidyl-peptidase 7 (DPP7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name DPP2 (DPP7) (NM_013379) Human 3' UTR Clone
Vector pMirTarget
Synonyms DPP2; DPPII; QPP
ACCN NM_013379
Insert Size 132 bp
Sequence Data
>SC200986 3’UTR clone of NM_013379
The sequence shown below is from the reference sequence of NM_013379. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTGCGTGGGGGGCCCAGACTCAGCCTCTGAGCACAGGACTGGAGGGGTCTCAAGGCTCCTCATGGAGTG
GGGGCTTCACTCAAGCAGCTGGCGGCAGAGGGAAGGGGCTGAATAAACGCCTGGAGGCCTGGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_013379.3
Synonyms DPP2; DPPII; QPP
Summary The protein encoded by this gene is a post-proline cleaving aminopeptidase expressed in quiescent lymphocytes. The resting lymphocytes are maintained through suppression of apoptosis, a state which is disrupted by inhibition of this novel serine protease. The enzyme has strong sequence homology with prolylcarboxypeptidase and is active at both acidic and neutral pH. [provided by RefSeq, Jul 2008]
Locus ID 29952
MW 4.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...