RIPPLY2 (NM_001009994) Human 3' UTR Clone

CAT#: SC201000

3' UTR clone of ripply2 homolog (zebrafish) (RIPPLY2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name RIPPLY2 (NM_001009994) Human 3' UTR Clone
Vector pMirTarget
Synonyms C6orf159; dJ237I15.1; SCDO6
ACCN NM_001009994
Insert Size 156 bp
Sequence Data
>SC201000 3’UTR clone of NM_001009994
The sequence shown below is from the reference sequence of NM_001009994. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAATTGAGGATCTGACCTGTGAAAATTAATCTGATTAGCTACTTTTGATTATATCCAAAGCTTGTGGG
GTTTAAATTTAGTGTACAAATGTATCATAATTATTTTAAACTAATTTATTTGTATATAAATTATTAATA
AAATGAAATATTTTGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001009994.3
Synonyms C6orf159; dJ237I15.1; SCDO6
Summary This gene encodes a nuclear protein that belongs to a novel family of proteins required for vertebrate somitogenesis. Members of this family have a tetrapeptide WRPW motif that is required for interaction with the transcriptional repressor Groucho and a carboxy-terminal Ripply homology domain/Bowline-DSCR-Ledgerline conserved region required for transcriptional repression. Null mutant mice die soon after birth and display defects in axial skeleton segmentation due to defective somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Locus ID 134701
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...