GRK4 (NM_001004057) Human 3' UTR Clone

CAT#: SC201050

3' UTR clone of G protein-coupled receptor kinase 4 (GRK4) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name GRK4 (NM_001004057) Human 3' UTR Clone
Vector pMirTarget
Synonyms GPRK2L; GPRK4; GRK4a; IT11
ACCN NM_001004057
Insert Size 165 bp
Sequence Data
>SC201050 3’UTR clone of NM_001004057
The sequence shown below is from the reference sequence of NM_001004057. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGAAGGAAGTGGAACCCAAGCAATGCTGAGCACCCCGGTGCGGACCACAGAGCAGACCCTGGCGCCAG
GAAGGAGCATGTGTTAGCGTCTCGTCCCACCTGGAATTGTAATAAATACATCTAAATAAAACATGCCTT
GGGAGTGTACAGACCTTTCTGCACTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001004057.2
Synonyms GPRK2L; GPRK4; GRK4a; IT11
Summary This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
Locus ID 2868
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...