Myosin 8 (MYH8) (NM_002472) Human 3' UTR Clone

CAT#: SC201051

3' UTR clone of myosin heavy chain 8 skeletal muscle perinatal (MYH8) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Myosin 8 (MYH8) (NM_002472) Human 3' UTR Clone
Vector pMirTarget
Synonyms DA7; gtMHC-F; MyHC-peri; MyHC-pn
ACCN NM_002472
Insert Size 162 bp
Sequence Data
>SC201051 3’UTR clone of NM_002472
The sequence shown below is from the reference sequence of NM_002472. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAGGTTCACACAAAAATCAGTGCAGAGTAAACACACCTGCCTGATGCTATCAAGAGGCTGAAGAAAGGC
ACAAAATGTGCTATTTTTGGTCACTTGCTTTATGACGTTTATTTTCCTGTTAAAGCTGAATAAATAAAA
ACTACAGTAAATGTATACATTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002472.3
Synonyms DA7; gtMHC-F; MyHC-peri; MyHC-pn
Summary Myosins are actin-based motor proteins that function in the generation of mechanical force in eukaryotic cells. Muscle myosins are heterohexamers composed of 2 myosin heavy chains and 2 pairs of nonidentical myosin light chains. This gene encodes a member of the class II or conventional myosin heavy chains, and functions in skeletal muscle contraction. This gene is predominantly expressed in fetal skeletal muscle. This gene is found in a cluster of myosin heavy chain genes on chromosome 17. A mutation in this gene results in trismus-pseudocamptodactyly syndrome. [provided by RefSeq, Sep 2009]
Locus ID 4626
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...