CARS2 (NM_024537) Human 3' UTR Clone

CAT#: SC201069

3' UTR clone of cysteinyl-tRNA synthetase 2 mitochondrial (putative) (CARS2) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name CARS2 (NM_024537) Human 3' UTR Clone
Vector pMirTarget
Synonyms COXPD27; cysRS
ACCN NM_024537
Insert Size 150 bp
Sequence Data
>SC201069 3’UTR clone of NM_024537
The sequence shown below is from the reference sequence of NM_024537. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGACAAAAGACCAAAAATCAGCGGGCTGAGGATGGAGCACAGCCATGAACCTGCTCACGACAAGACGC
ACCCATGCTTCTCAGGGTCAAGGCTTTATGTTAAAGCTTCCTGTCGGGGCTGCTAGGTCAGCATTAAAG
TAAGGCAACCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_024537.4
Synonyms COXPD27; cysRS
Summary This gene encodes a putative member of the class I family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of cysteine to tRNA molecules. A splice-site mutation in this gene has been associated with a novel progressive myoclonic epilepsy disease with similar symptoms to MERRF syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2017]
Locus ID 79587
MW 5.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...