UBL5 (NM_001048241) Human 3' UTR Clone

CAT#: SC201090

3' UTR clone of ubiquitin-like 5 (UBL5) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name UBL5 (NM_001048241) Human 3' UTR Clone
Vector pMirTarget
Synonyms HUB1
ACCN NM_001048241
Insert Size 137 bp
Sequence Data
>SC201090 3’UTR clone of NM_001048241
The sequence shown below is from the reference sequence of NM_001048241. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGATGAACCTGGAGCTTTATTATCAATAGATGAGAATCCTCATCTTCCTGCCCCGCTTTCCTCTCCCA
TCCTCATCCCCCACACTGGGATAGATGCTTGTTTGTAAAAACTCACCTTAATAAAGACTTAGATGTTG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001048241.3
Synonyms HUB1
Summary This gene encodes a member of a group of proteins similar to ubiquitin. The encoded protein is not thought to degrade proteins like ubiquitin but to affect their function through being bound to target proteins by an isopeptide bond. The gene product has been studied as a link to predisposition to obesity based on its expression in Psammomys obesus, the fat sand rat, which is an animal model for obesity studies. Variation in this gene was found to be significantly associated with some metabolic traits (PMID: 15331561) but not associated with childhood obesity (PMID: 19189687). Pseudogenes of this gene are located on chromosomes 3, 5 and 17. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2013]
Locus ID 59286
MW 5.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...