ARA9 (AIP) (NM_003977) Human 3' UTR Clone

CAT#: SC201113

3' UTR clone of aryl hydrocarbon receptor interacting protein (AIP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name ARA9 (AIP) (NM_003977) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARA9; FKBP16; FKBP37; PITA1; SMTPHN; XAP-2; XAP2
ACCN NM_003977
Insert Size 140 bp
Sequence Data
>SC201113 3’UTR clone of NM_003977
The sequence shown below is from the reference sequence of NM_003977. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCCCGGTTCCGGGGGATCTTCTCCCATTGACAGGAGCACTTGGCCCTGCCTTACCTGCCAAGCCCACTG
CTGCAGCTGCCAGCCCCCCTGCCCGTGCTGCGTCATGCTTCTGTGTATATAAAGGCCTTTATTTATCTC
TC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003977.4
Synonyms ARA9; FKBP16; FKBP37; PITA1; SMTPHN; XAP-2; XAP2
Summary The protein encoded by this gene is a receptor for aryl hydrocarbons and a ligand-activated transcription factor. The encoded protein is found in the cytoplasm as part of a multiprotein complex, but upon binding of ligand is transported to the nucleus. This protein can regulate the expression of many xenobiotic metabolizing enzymes. Also, the encoded protein can bind specifically to and inhibit the activity of hepatitis B virus. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2014]
Locus ID 9049
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...