TIGD7 (NM_033208) Human 3' UTR Clone

CAT#: SC201131

3' UTR clone of tigger transposable element derived 7 (TIGD7) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name TIGD7 (NM_033208) Human 3' UTR Clone
Vector pMirTarget
Synonyms Sancho
ACCN NM_033208
Insert Size 187 bp
Sequence Data
>SC201131 3’UTR clone of NM_033208
The sequence shown below is from the reference sequence of NM_033208. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGGCCTTCAACTTCTGGTTCTAATCATTAGATTTTGTGTTTAAAGATTTCTGCCATTATATGATGTAGG
CCAGCTGTGAATTGTCTTGTTTTAGCAACTGACATTATTTTGTATATCAGTGCCCATTTATATAATGGT
TATAAAATTTACAGTTTGAAAATAATACATTTGTGTTTCTTTAAATTTA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_033208.4
Synonyms Sancho
Summary The protein encoded by this gene belongs to the tigger subfamily of the pogo superfamily of DNA-mediated transposons in humans. These proteins are related to DNA transposons found in fungi and nematodes, and more distantly to the Tc1 and mariner transposases. They are also very similar to the major mammalian centromere protein B. The exact function of this gene is not known. [provided by RefSeq, Jul 2008]
Locus ID 91151
MW 6.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...