LAIR2 (NM_021270) Human 3' UTR Clone

CAT#: SC201133

3' UTR clone of leukocyte-associated immunoglobulin-like receptor 2 (LAIR2) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name LAIR2 (NM_021270) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD306
ACCN NM_021270
Insert Size 148 bp
Sequence Data
>SC201133 3’UTR clone of NM_021270
The sequence shown below is from the reference sequence of NM_021270. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACTGAAGCCTCCGGATTTGATGCACCATGAATGAGGAGAAATGGCCTCCCGTCTTGTGAACTTCAATGG
GGAGAAATAATTAGAATGAGCAATAGAAATGCACAGATGCCTATACATACATATACAAATAAAAAGATA
CGATTCGCAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_021270.5
Synonyms CD306
Summary The protein encoded by this gene is a member of the immunoglobulin superfamily. It was identified by its similarity to leukocyte-associated immunoglobulin-like receptor 1, a membrane-bound receptor that modulates innate immune response. The protein encoded by this locus is a soluble receptor that may play roles in both inhibition of collagen-induced platelet aggregation and vessel formation during placental implantation. This gene maps to a region of 19q13.4, termed the leukocyte receptor cluster, which contains 29 genes in the immunoglobulin superfamily. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
Locus ID 3904
MW 5.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...