MDA5 (IFIH1) (NM_022168) Human 3' UTR Clone

CAT#: SC201156

3' UTR clone of interferon induced with helicase C domain 1 (IFIH1) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name MDA5 (IFIH1) (NM_022168) Human 3' UTR Clone
Vector pMirTarget
Synonyms AGS7; Hlcd; IDDM19; MDA-5; MDA5; RLR-2; SGMRT1
ACCN NM_022168
Insert Size 156 bp
Sequence Data
>SC201156 3’UTR clone of NM_022168
The sequence shown below is from the reference sequence of NM_022168. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAATGCTGTTTATTTAGTGATGAGGATTAGCACTTGATTGAAGATTCTTTTAAAATACTATCAGTTAAA
CATTTAATATGATTATGATTAATGTATTCATTATGCTACAGAACTGACATAAGAATCAATAAAATGATT
GTTTTACTCTGCATTGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022168.4
Synonyms AGS7; Hlcd; IDDM19; MDA-5; MDA5; RLR-2; SGMRT1
Summary IFIH1 encodes MDA5 which is an intracellular sensor of viral RNA that triggers the innate immune response. Sensing RNA length and secondary structure, MDA5 binds dsRNA oligonucleotides with a modified DExD/H-box helicase core and a C-terminal domain, thus leading to a proinflammatory response that includes interferons. It has been shown that Coronaviruses (CoVs) as well as various other virus families, are capable of evading the MDA5-dependent interferon response, thus impeding the activation of the innate immune response to infection. MDA5 has also been shown to play an important role in enhancing natural killer cell function in malaria infection. In addition to its protective role in antiviral responses, MDA5 has been implicated in autoimmune and autoinflammatory diseases such as type 1 diabetes, systemic lupus erythematosus, and Aicardi-Goutieres syndrome[provided by RefSeq, Jul 2020]
Locus ID 64135
MW 6.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...