SLC16A5 (NM_004695) Human 3' UTR Clone

CAT#: SC201166

3' UTR clone of solute carrier family 16 member 5 (monocarboxylic acid transporter 6) (SLC16A5) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SLC16A5 (NM_004695) Human 3' UTR Clone
Vector pMirTarget
Synonyms MCT5; MCT6
ACCN NM_004695
Insert Size 159 bp
Sequence Data
>SC201166 3’UTR clone of NM_004695
The sequence shown below is from the reference sequence of NM_004695. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
ACGGCTCTGGGCTGGAATAGCCCTACCTGAGTGCCCTGTTTGACTCCGCCACTATCTGCCATGTGAGTT
GGGCAAATTGTTGACCACCTCTGAGCCTTGAAAAAGTAGGAGGTTACTTTGTTAGAGCAAAATAATAAA
ATTTAATTTTAAAAAAGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_004695.4
Synonyms MCT5; MCT6
Summary This gene encodes a member of the monocarboxylate transporter family and the major facilitator superfamily. The encoded protein is localized to the cell membrane and acts as a proton-linked transporter of bumetanide. Transport by the encoded protein is inhibited by four loop diuretics, nateglinide, thiazides, probenecid, and glibenclamide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Locus ID 9121
MW 5.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...