APPBP1 (NAE1) (NM_001018160) Human 3' UTR Clone

CAT#: SC201211

3' UTR clone of NEDD8 activating enzyme E1 subunit 1 (NAE1) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name APPBP1 (NAE1) (NM_001018160) Human 3' UTR Clone
Vector pMirTarget
Synonyms A-116A10.1; APPBP1; HPP1; ula-1
ACCN NM_001018160
Insert Size 161 bp
Sequence Data
>SC201211 3’UTR clone of NM_001018160
The sequence shown below is from the reference sequence of NM_001018160. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCACAAACTTCAGCAACTTTCCAGTTGTAGAGTAAGCAAGCACCTTAAGTAGTGTGTTAATGATTGAAA
CTGTAATTGCCTTCGGGTTGTGCTTTAGTCTGTAAAATTCTAAAGGAGAGCTGCTAAATTGTTTTCTTA
ATAAACATTTTTCTCATTTGTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001018160.2
Synonyms A-116A10.1; APPBP1; HPP1; ula-1
Summary The protein encoded by this gene binds to the beta-amyloid precursor protein. Beta-amyloid precursor protein is a cell surface protein with signal-transducing properties, and it is thought to play a role in the pathogenesis of Alzheimer's disease. In addition, the encoded protein can form a heterodimer with UBE1C and bind and activate NEDD8, a ubiquitin-like protein. This protein is required for cell cycle progression through the S/M checkpoint. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Locus ID 8883
MW 5.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...