PCDHGB7 (NM_032101) Human 3' UTR Clone

CAT#: SC201295

3' UTR clone of protocadherin gamma subfamily B 7 (PCDHGB7) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name PCDHGB7 (NM_032101) Human 3' UTR Clone
Vector pMirTarget
Synonyms ME6; PCDH-GAMMA-B7
ACCN NM_032101
Insert Size 180 bp
Sequence Data
>SC201295 3’UTR clone of NM_032101
The sequence shown below is from the reference sequence of NM_032101. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGAAGATTCTTAAACAGGTAAGTATTTAAAAATGTATTTAATCCTTTTTATATTACAATATGCCAATA
TATTCCAATATAGTGGTATTATTTTAAGATTCTAGATAACTTCTTCATAGAGTTCGCAAAATATAGGTC
AAATTTATGGTTATCATTATTAAAACAAAAGTTTAAATTAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032101.3
Synonyms ME6; PCDH-GAMMA-B7
Summary This gene is a member of the protocadherin gamma gene cluster, one of three related clusters tandemly linked on chromosome five. These gene clusters have an immunoglobulin-like organization, suggesting that a novel mechanism may be involved in their regulation and expression. The gamma gene cluster includes 22 genes divided into 3 subfamilies. Subfamily A contains 12 genes, subfamily B contains 7 genes and 2 pseudogenes, and the more distantly related subfamily C contains 3 genes. The tandem array of 22 large, variable region exons are followed by a constant region, containing 3 exons shared by all genes in the cluster. Each variable region exon encodes the extracellular region, which includes 6 cadherin ectodomains and a transmembrane region. The constant region exons encode the common cytoplasmic region. These neural cadherin-like cell adhesion proteins most likely play a critical role in the establishment and function of specific cell-cell connections in the brain. Alternative splicing has been described for the gamma cluster genes. [provided by RefSeq, Jul 2008]
Locus ID 56099
MW 7.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...