Ryanodine Receptor (RYR1) (NM_001042723) Human 3' UTR Clone

CAT#: SC201309

3' UTR clone of ryanodine receptor 1 (skeletal) (RYR1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Ryanodine Receptor (RYR1) (NM_001042723) Human 3' UTR Clone
Vector pMirTarget
Synonyms CCO; MHS; MHS1; PPP1R137; RYDR; RYR; RYR-1; SKRR
ACCN NM_001042723
Insert Size 174 bp
Sequence Data
>SC201309 3’UTR clone of NM_001042723
The sequence shown below is from the reference sequence of NM_001042723. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGTAAGCAGTATGAGGACCAGCTTAGCTGACACACCCCCAGCTGGCCCTCCACCCCCACCTCAAGTGCC
TTATTCTCACAGCAAGCCCCTTAGTCCCCAAGCCCCTCCCCCTAAGGCAGCTGGGGGAGAGGTGACCTA
GTACTGGAAAATAAATCTGTGCTACGCCCCCCAGCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001042723.2
Synonyms CCO; MHS; MHS1; PPP1R137; RYDR; RYR; RYR-1; SKRR
Summary This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Locus ID 6261
MW 6.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...