SLC39A4 (NM_130849) Human 3' UTR Clone

CAT#: SC201363

3' UTR clone of solute carrier family 39 (zinc transporter) member 4 (SLC39A4) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name SLC39A4 (NM_130849) Human 3' UTR Clone
Vector pMirTarget
Synonyms AEZ; AWMS2; ZIP4
ACCN NM_130849
Insert Size 154 bp
Sequence Data
>SC201363 3’UTR clone of NM_130849
The sequence shown below is from the reference sequence of NM_130849. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TCCCTGTACGAGGATGACATCACCTTCTGATACCCTGCCCTAGTCCCCCACCTTTGACTTAAGATCCCA
CACCTCACAAACCTACAGCCCAGAAACCAGAAGCCCCTATAGAGGCCCCAGTCCCAACTCCAGTAAAGA
CACTCTTGTCCTTGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_130849.4
Synonyms AEZ; AWMS2; ZIP4
Summary This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
Locus ID 55630
MW 6.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...