Apolipoprotein M (APOM) (NM_019101) Human 3' UTR Clone

CAT#: SC201389

3' UTR clone of apolipoprotein M (APOM) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4845.00


货期*
3周

规格
    • 10 ug

Product images

推荐一起购买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1280.00

Specifications

Product Data
Product Name Apolipoprotein M (APOM) (NM_019101) Human 3' UTR Clone
Vector pMirTarget
Synonyms apo-M; G3a; HSPC336; NG20
ACCN NM_019101
Insert Size 151 bp
Sequence Data
>SC201389 3’UTR clone of NM_019101
The sequence shown below is from the reference sequence of NM_019101. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CAAGAGGCCTGTGAGCTGTCCAATAACTGACCTGTAACTTCATCTAAGTCCCCAGATGGGTACAATGGG
AGCTGAGTTGTTGGAGGGAGAAGCTGGAGACTTCCAGCTCCAGCTCCCACTCAAGATAATAAAGATAAT
TTTTCAATCCTCA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_019101.3
Synonyms apo-M; G3a; HSPC336; NG20
Summary The protein encoded by this gene is an apolipoprotein and member of the lipocalin protein family. It is found associated with high density lipoproteins and to a lesser extent with low density lipoproteins and triglyceride-rich lipoproteins. The encoded protein is secreted through the plasma membrane but remains membrane-bound, where it is involved in lipid transport. Alternate splicing results in both coding and non-coding variants of this gene. [provided by RefSeq, Jan 2012]
Locus ID 55937
MW 5.3
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...